Home » Services » Applied Genomics » Services » Diversity Profiling

Diversity Profiling


AGRF’s Diversity Profiling service is a way of identifying the relative proportion of organisms present in a mixed microbial community.

To do this, AGRF will take your sample (either raw sample, or extracted gDNA) and PCR-amplify a region of interest from your mixed community. We will then pool and sequence the barcoded amplicon(s) on the GS-FLX platform.


AGRF has validated fusion primers that can directly amplify many of the popular regions:

Target Name

Forward Sequence

Reverse Sequence

16S:27F-519R

AGAGTTTGATCMTGGCTCAG

GWATTACCGCGGCKGCTG

16S:341F - 806R

CCTAYGGGRBGCASCAG

GGACTACNNGGGTATCTAAT

18S:Fungal ITS1F-ITS4

CTTGGTCATTTAGAGGAAGTAA

TCCTCCGCTTATTGATATGC

18S:Algal (Euk1A-Euk516)

CTGGTTGATCCTGCCAG

CCAGACTTGCCCTCC

Note: if you have a region of interest that is not listed, please contact us.

Pricing

To allow greater flexibility, the AGRF Diversity profiling service has enabled two points of entry. These two levels of entry are either submissions of raw samples or extracted gDNA.

DNA extraction (if required): $16 per sample (note: minimum charge $32)
PCR amplification, GS-FLX sequencing and bioinformatics analysis: $200 per target, per sample
Discounted pricing is available for larger sample numbers, please contact us.

Submission Guide

Click here for further details regarding sample submission, workflow and results - Diversity Profiling Sample Submission Guide

Data Formats

Results for the diversity profiling service are accompanied by a report, this report provides an overview of the data analysis performed - EXAMPLE Service Report.

A description of each of the results analysis files and its contents are listed below...

Recent News